Introduction

Zinc is not only an essential substance for regulating proliferation and metabolism, but also an intracellular second messenger and the cellular level of ionic, zinc homeostasis in cells are controlled by multiple transporters, including distinct families, such as Zn-regulated transporter, iron (Fe)-regulated transporter-like proteins (ZIPs), metal tolerance proteins (MTPs), and heavy metal ATPases (HMAs) (Palmer and Guerinot 2009; Thomas et al. 2018; Gao et al. 2019). In mammals, zinc homeostasis is primarily regulated by ZIP and ZnT zinc transporters, the importance and functions especially on human diseases of these transporters had been well reviewed (Thingholm et al. 2020) while there are relatively few studies on zinc transporter protein such as ZIP in plants. Recent studies have revealed the molecular mechanisms governing the uptake and accumulation of Zn in tobacco (Kozak et al. 2019), rice (Gao et al. 2019; Wang et al. 2020) and Arabidopsis, oxidative and biotic stress responses in the Arabidopsis (Scheepers et al. 2020). ZIP transporter is predicted to have 8 transmembrane domains. The metal binding domain provided by the histidine residue will form a very conservative histidine amphiphilic helix structure, which may be part of the transport of metal binding sites in the membrane. If there was a mutation in the residue, the transport function will disappear (Guerinot 2000).

Sixteen members of the ZIP gene family have been identified on the x`whole genome of the model plant Arabidopsis thaliana (Milner et al. 2013). ZIP has been shown to be related to the absorption and transport of metals by plants (Grotz et al. 1998; Plaza et al. 2007; Pedas et al. 2008; Assunção et al. 2010). A. thaliana ZIP1, ZIP3 and ZIP4 restored zinc uptake by yeast Zn-uptake mutants Dzrt1 and Dzrt2, and were considered to play an important role in transport of zinc. When zinc is deficient, the expression of ZIP1 and ZIP3 increased in roots, which indicated that they played an important role in zinc transport while ZIP4 was expressed in roots and buds at the same time, indicating that it transports zinc in cells (Grotz et al. 1998; Guerinot 2000).

A total of 17 ZIP family members were predicted in the whole genome of Oryza sativa, eight of these genes have been reported. The ZIP gene-encoded polypeptide in rice has approximately 276–687 amino acids and contains 8 transmembrane (TM) domains (Yang et al. 2009). Ninety-four per cent of the protein predictions had the typical secondary structure of the ZIP family. Most ZIP proteins are located on the cell membrane, maybe OsZIP10 is located in the chloroplast, and OsZIP16 is located in the vacuole. When rice was zinc deficient, OsZIP1 and OsZIP3 were up-regulated. These results suggest that they are zinc transporters regulated by zinc on the plasma membrane and are responsible for zinc transport (Ramesh et al. 2004).

Three new zinc transporters of Hordeum vulgare, HvZIP3, HvZIP5 and HvZIP8, have 350–362 amino acids, and their encoded proteins are highly similar to ZIP family proteins. In barley roots, HvZIP8 was expressed under normal conditions, while HvZIP3 and HvZIP5 were expressed in the absence of zinc. These results proved that HvZIP3, HvZIP5 and HvZIP8 were zinc transporters and were involved in the balance of zinc in barley roots (Pedas et al. 2009).

Thirty-three genes related to zinc and iron transport have been identified in corn (Zea mays) genome, but only 9 of them belong to the ZIP family. There are 7–9 transmembrane domains in the ZmZIP family. For example, ZmZIP4 cDNA, with a full length of 1161 bp, is composed of a polypeptide with 386 amino acid residues, contained 7 transmememal domains, and its encoded protein is located on the lipid membrane (Xu et al. 2010).

Potato is one of the three food crops that human beings depend on for survival (Bali et al. 2018). It has rich nutrition, strong adaptability, good yield, rich nutrition, high economic benefits, and is suitable for processing (Bali et al. 2018). It plays an important role in the structure of food safety. With the wide application of bioinformatics approaches, many gene families in potato have been identified and completed related bioinformation analysis, such as SBP transcription factor family (Kavas et al. 2017) and ARF family (Song et al. 2019). However, the ZIP gene family has not been reported in potatoes, but only in Arabidopsis, rice, barley and corn. In this study, taking advantage of the DM potato reference genome, we conducted a genome-wide, comprehensive analysis of ZIP family genes in potato. A total of 29 StZIP (Solanum tuberosum ZIP) genes were identified, and the physical and chemical characteristics, genomic structures, chromosomal locations, evolutionary relationship, expression profiles of StZIP family were investigated in detail. In our previous work, a suppression subtractive hybridization (SSH) cDNA library library was created (Kong et al. 2016) to enrich the up-regulated genes induced by R. solanacearum in potato. A StZIP12 gene was found, induced by biotic and abiotic stress, and analyzed in combination with the results of bioinformatics. This will lay a foundation for further research on the function of this gene.

Materials and Methods

Plant material and growth conditions

The potato (diploid genotype ED13) plants used in this study were provided by the Chinese Academy of Agricultural Sciences (CAAS). Potato ED13 genotype was resistant to bacterial wilt (Pang et al. 2019). Aseptic tuber ED13 was planted in pots containing 450 mL peat and vermiculite (3: 1, volume ratio) (10 cm, in diameter and 15 cm in height). The culture conditions were as follows: 16 h light (24°C)/8 h dark (18°C) photoperiod (light intensity approximately 3,000 lx) with 75% relative humidity (Pang et al. 2019).

Identification and characterization of potato StZIP family

Referring to the previous methods (Peng et al. 2019), the complete potato StZIP gene was obtained. All StZIP gene candidates were analyzed using the Hidden Markov Model (HMM) (Liang et al. 2016). Physical properties such as peptide length, isoelectric point and molecular weight, and subcellular localization were completed by ExPASy and PSORT online tools.

Phylogenetic tree analysis

A phylogenetic tree was constructed with MEGA 7 using Neighbor-Joining (NJ) method (Dereeper et al. 2010).

Conserved motif analysis, chromosome mapping and gene structure analysis of StZIP

The conserved domain of the protein was analyzed by online software MEME (Zou et al. 2019). The chromosomal locations information was retrieved from potato genome data and these data were downloaded from the phytozome (Liang et al. 2017). The gene structure of StZIP was analyzed by GSDS website.

Digital expression analysis of StZIP protein

Based on the digital expression data retrieved by previous methods (Nussbaumer et al. 2014), the expression of StZIP members in four tissues and developmental stages was studied.

Promoter sequence analysis

The base of the 5′ upstream 2000 bp of the initiation codon ATG of the StZIP gene family was obtained from the potato genomic DNA, and then Plant CARE was used to search the promoter region in the download sequence, to analyze each binding site and predict its potential cis-acting elements (Lescot et al. 2002).

Hormone treatment

According to the previous work (Blaudez et al. 2003), Five pots containing five potato plants at the seven or eight compound leaf-stage were sprayed with 100 μmol/L ABA solution respectively with distilled water as control. After spraying, all samples are covered with black plastic bags to maintain humidity and prevent hormone volatilization. The aboveground parts of plants were sampled at 0, 24, 48, 72, 96 and 120 h after treatment, frozen in liquid nitrogen and stored at -80 C for RNA preparation (Denancé et al. 2013).

Inoculation

Potato seedlings of 7–8 leaf age were treated with 10⁸ cfu/mL (OD600=0.2) solution and inoculated with root injury irrigation method (He et al. 1983). Control plants were inoculated with an equal volume of water. Stem samples were collected at 6, 12, 24, 36, 48, 60, 72, 84, 96 and 108 h after the inoculation, wrapped with aluminum foil, placed in liquid nitrogen for 20 min.

Quantitative real-time polymerase chain reaction

In our previous work, a suppression subtractive hybridization (SSH) cDNA library was created and the EST of the StZIP12 gene was found to up-regulated induced by R. solanacearum in potato. qRT-PCR reference Schmittgen’S method (Schmittgen and Livak 2008), potato Actin gene is internal reference gene (GenBank Accession: X55747).

The subsequent qRT-PCR was completed with the following primers: StZIP12-F: GTTGCCATCGGAATCATAATCG, StZIP12-R: ATGAGACTTGTCAATCG AGACC; internal reference; Actin-F: TATAACGAGCTTCGTGTTGCAC, Actin-R: ACTGGCATACAGCGAAAGAACA. The fragment size of PCR product is 168 bp. The qRT-PCR reaction procedure was as follows: preheating at 94°C 2 min, 94°C cycle 5 s, 58°C cycle 15 s, 72°C cycle 10 s, 45 cycles, and the experiment was repeated 3 times.

Fluorescence in situ hybridization

The bacterial liquid of R. solanacearum strain PO41 (Biovar 2, race 3, 10⁸ colony forming units/mL) was used to infect ED13 seedlings. After 48 hours of inoculation, a small number of leaves and 2–3 stem segments (6–7 cm), were collected from each seedling and put into the 10 mL centrifuge tube. The plant material was immersed in a fixative comprising 85 mL 50% ethanol, 10 mL 37% formaldehyde, 5 mL glacial acetic acid and 0.1% DEPC. An RNA probe was generated from the StZIP12 gene fragment amplified by PCR, labeled with 5-FAM, and added to the paraffin section made from previously prepared samples. The StZIP12 probe sequence was 5′- CATCAGAGACCTGTGACTGCCCTTGTGCGACT-3′, and the probe concentration was used at 100 μmol/L.

Results

Genome-wide identification of StZIP genes

Twenty-nine StZIP genes were named StZIP1-29. The study shows that the minimum amino acid number of the StZIP gene family was 91 and the largest was 595, and its molecular weights were between 9.52 kDa and 61.74 kDa. Their isoelectric points (pIs) were predicted to range from 4.83 to 9.43 and StZIP were predicted to be localized in the plasma membrane, mitochondrial inner membrane, and endoplasmic reticulum membrane (Table 1).

Phylogenetic analysis of StZIP protein

In order to study the families of StZIP, using MEGA7.0, the phylogenetic tree of 29 amino acid sequences of StZIP domain was constructed by NJ method. The StZIP gene family was divided into three different groups, I to III (Fig. 1).

Chromosomal location and gene structure of StZIPs

Using MapInspect tool, all StZIPs were located on 12 chromosomes, and the location map of StZIP was drawn. Twenty-nine StZIP was found in seven chromosomes out of twelve, and these genes were unevenly distributed on the chromosomes. Chromosome 2 had the largest number of StZIP, with 10 (about 34.4%), while chromosomes 5 contain only one StZIP. In addition, eighteen StZIP genes shared close physical distances on the chromosomes. The structural distribution of exons and introns of StZIP was obtained by analyzing the functional genome database of potato. The number of introns varied from 0 to 4. Out of the twenty-nine StZIPs, the shortest intron was in StZIP16, while the longest intron was in StZIP22. The number of exons of StZIP family members varies, consisting of 1–5 exons, of which the shortest exon was in StZIP26 and StZIP27, while the longest exon was in StZIP17, StZIP18 and StZIP19 (Fig. 2).

Conserved motif analysis

The complete sequences of 29 StZIP proteins were used for protein sequence alignment and phylogenetic analysis. To further understand the evolutionary relationship and conserved motif of StZIP protein. According to Fig. 3, Twenty-nine StZIP proteins were divided into three subgroups, and 10 motifs were identified. therefore, we speculated that the subclass proteins in the same subgroup had similar conserved motif structure.

Cis-acting elements analysis in the promoter regions of StZIP

Table 1: Genome-wide identification of StZIP genes

Fig. 1: Phylogenetic analysis of StZIP genes. A phylogenetic tree constructed using the neighborjoining (NJ) method in MEGA 7.0. Parameters were set as pairwise alignment, and 1000 bootstrap replicates. Branch lines with different colors indicated different subgroups. The proteins on the tree can be divided into three distinct subfamilies, which are indicated by different colored backgrounds

The potential cis-elements were analyzed by Plant Care database. The results showed that there were many plant hormone action sites in the promoter region of StZIP gene. For example: Abscisic Acid (ABRE), MeJA responsiveness (TGACG-motif) and Salicylic Acid (TCA-element). Therefore, we speculated the potential role of StZIPs in development, stress adaptation and various hormone signaling pathways (Fig. 4).

Fig. 2: Chromosomal location and gene structure of ZIP. (a) Chromosomal distribution of StZIP. Vertical bars indicate locus of SotubMCs on potato chromosomes. Chromosome number is mentioned at the bottom of each chromosome. (b) The exon-intron structure of StZIP genes visualized by online tool GSDS 2.0, yellow boxes indicated exons and gray lines indicated introns

Fig. 3: Conserved motif analysis of StZIP genes. (a) The conserved motif of StZIP proteins analyzed by online program MEME server, different colored boxes indicated different motifs. (b) Highly conserved amino acid residues across all StZIPs

Conserved microsynteny of StZIP genes from two species

We identified some one-to-one micro collinearities between potato and tomato ZIP genes, nine pairs showed one-to-one microsynteny. For example,

ZIP9/Soly02g081600,ZIP6/Soly02g069190,ZIP5/Soly02g032100,ZIP21/Soly02g053370,ZIP25/Soly02g005260,ZIP15/Soly02g043200,ZIP12/Soly02g065380,ZIP26/Soly02g0065190,ZIP19/Soly02g087530 (Fig. 5).

Fig. 4: Cis-acting elements analysis in the promoter regions of StZIP. ABRE, Abscisic acid responsive element; TGACG-motif, involved in MeJA responsiveness; TCA-element, Salicylic acid responsive element; TC-rich repeats, involved in defense and stress responsiveness; CGTCA motif, involved in Methyl-jasmonic acid (MeJA) response

Fig. 5: Comparative orthologous relationships of ZIP from potato and tomato. Orthomcl was used to analyze the gene homology relationship between potato and tomato ZIP gene families, and Circos was used to visualize the gene chromosome localization and homology relationship. ZIP genes connecting potato genome and tomato genome are shown in colored links

Expression profile of StZIP genes in various organs and tissues

The expression data for StZIPs have been retrieved from RNASeq Expression Browser. Ten of the StZIPs (StZIP1, StZIP4, StZIP11, StZIP15, StZIP16, StZIP20, StZIP21, StZIP22 and StZIP24) did not express in root and eleven of the StZIPs (StZIP1, StZIP4, StZIP3, StZIP5, StZIP8, StZIP10, StZIP11, StZIP15, StZIP16, StZIP20 and StZIP24) did not express in stem. On the contrary, StZIP12, StZIP17 and StZIP26 were expressed in different tissues and at different developmental stages (Fig. 6).

Fig. 6: Heat map showing expression profiles of StZIPs in different tissues. Heat-map showing expression patterns of StZIP in roots, stems, leaves and tuber based on RNA seq data. The Illumina RNA-seq data were reanalyzed, and the relative expression was calculated with respect to control samples

Fig. 7: The relative expression of StZIP12 gene in potato seedlings treated with hormone ABA was analyzed by real-time quantitative PCR. Mean ± standard deviation

(SD) (n=3 independent experiments, t-test)

StZIP12 expression patterns elicited by phytohormones

The expression of StZIP12 was up-regulated by the exogenous hormone ABA (Fig. 7). The relative expression of the gene reached the highest peak after 72 h of ABA treatment. However, the expression decreased significantly at 96 h, and began to increase at 120 h. ABA could strongly stimulate the up-regulated expression of StZIP12 gene, indicating that the expression of StZIP12 may play an important role in the process of hormone signal transduction.

StZIP12 expression levels induced by R. solanacearum

In investigate whether StZIP12 responded to R. solanacearum treatment. The induced expression of StZIP12 mRNA in potato seedlings inoculated with R. solanacearum was compared and analyzed by qRT-PCR method (Fig. 8). The results showed that after induction by R. solanacearum, the expression of StZIP12 gene in the plant was smooth before 72 h, but increased 12-fold at 86 h, reached the highest level, and then gradually decreased at 96 h and 108 h. The expression level of StZIP12 gene in plants is low when plants are not under stress. Under the stress of R. solanacearum, the expression of StZIP12 gene in plants was up-regulated. Thus it could be seen that StZIP12 gene was activated and expressed after infection with R. solanacearum and played an important role in potato resistance to bacterial wilt.

Tissue localization of StZIP12 expression

Fluorescence in situ hybridization analysis showed that StZIP12 mRNA was mainly distributed in the phloem of stem vascular system (Fig. 9a3) and leaf vascular bundle (Fig. 9c3). In addition, weak hybridization signals were observed in the control plants (Fig. 9b3 and 9d3). These results showed that StZIP12 gene was located in vascular bundle and showed certain tissue specificity.

Discussion

First line indent analysis has been carried out in many model plants such as A. thaliana, O. sativa and Z. mays. There were sixteen ZIP family genes identified in A. thaliana (Milner et al. 2013), seventeen in O. sativa (Yang et al. 2009), and thirty-three in Z. mays (Xu et al. 2010). However, little was known about the potato ZIP (StZIP) gene family. Here, we identified and identified 29 StZIP genes (Table 1) and conducted comprehensive bioinformatics analysis (including chromosome mapping, phylogenetic analysis, gene structure, conserved motifs and cis elements in the promoter).

In this study, we identified 29 ZIP genes, which were divided into three groups in potato based on a comprehensive phylogenetic tree (Fig. 1). Phylogenetic analysis based on sequence alignments could be used as a rudimentary method to explore the molecular evolution of a gene family (Doxey et al. 2007), which meant that ZIP genes in the same clades may have similar functions. According to the result of MEME server, ten motifs were identified in StZIP proteins (Fig. 3). Expectedly, all of StZIP proteins contained a highly conserved ZIP domain (motif 1). By comparing the evolutionary tree and the conserved motifs of potato, we found that the conserved motifs of ZIP proteins changed when the potato ZIP protein evolved into a new family. With the occurrence of plant genome-wide events, genes were constantly evolving, mainly via appearance, loss and insertion of exons in genes. This research found that the numbers of exons in potato StZIPs were unequal, numbering 3–11 (Fig. 2b). After a series of comparisons, we found that StZIPs in the same subclade shared similar motifs composition and gene structures, which implied that they may play similar molecular roles (Xu et al. 2019). The chromosome distribution analysis revealed that the 29 genes appeared clustered and scattered (Fig. 2a), 29 StZIPs were found on 7 potato chromosomes.

In addition, abiotic and biotic stresses and stress-related hormones, such as ABA, were found in the promoter region of the StZIP gene (Fig. 4). Plant hormone ABA played an important role in abiotic stress responses, especially in drought and saline stress (Tuteja 2007), and ABA was considered to be an important participant in plant immunity (Grant and Jones 2009). Therefore, we examined the response of StZIP12 to the plant hormone ABA (Fig. 7). In addition, we also identified the biological function of StZIP12, which was regulating the resistance of potatoes to bacterial wilt (Fig. 8). Due to the interaction between R. solanacearum and plants in the potato seedling stage, in the early stage of infection by R. solanacearum, the plant spontaneous immune system protected against the invasion of pathogens through a series of defense pathways. In the late stage of R. solanacearum infection, a large number of R. solanacearum gathered in the vascular system of stems and leaves, blocking the pathways of nutrients and water led to plant wilting to death (Peeters et al. 2013). At that time, plants mainly deal with water stress, and StZIP12 participated in the ABA signal pathway to resist this water stress, which was the reason why StZIP12 was significantly up-regulated after 60 h of induction by R. solanacearum and in the later stage of ABA induction. This was consistent with Wang's result (Wang et al. 2019). Therefore, we speculated that in addition to the role of StZIP12 in plant growth and development. StZIP12 genes were also involved in responses to abiotic and biotic stresses, such as plant hormones and pathogens.

By comparing RNA-seq data, we could further understand the tissue expression pattern of StZIP family genes. In this study, ten StZIP genes (StZIP-2, 7, 14, 18, 19, 23, 25, 27, 28 and 29) were not expressed in five potato tissues. These results suggested that these genes may be pseudogenes or expressed only in specific environmental conditions or developmental stages. In addition, the other nineteen ZIPs genes were expressed in five potato tissues. Among them, StZIP8, StZIP12, StZIP17 and StZIP26 genes have high expression in roots. StZIP6, StZIP12, StZIP17, StZIP22 and StZIP26 were extremely highly expressed in the stems. StZIP12, StZIP13 and StZIP26 had high expression in leaves, and StZIP11, StZIP12, StZIP13, StZIP17 and StZIP26 had high expression in tubers. It was further found that the expression of StZIP gene in different subfamilies had certain specificity, and the expression of StZIP gene in the same subfamily was significantly different in different tissues, indicating that it may have multiple functions in potato. Combined with the results of fluorescence in situ hybridization (Fig. 9), StZIP12 was expressed in vascular bundles in a tissue-specific manner, and R. solanacearum also played a role in vascular bundles. Therefore, it was speculated that StZIP12 gene played an important role in potato resistance to bacterial wilt. Bacterial wilt of potato was a disease of vascular bundle system. R. solanacearum played a role from the invasion of plant root to the vessel of xylem, and expands rapidly to the above ground part through the vascular bundle, resulting in the loss of the function of the vessel and further wilting of the plant, even death (Peeters et al. 2013). Compared with the control group, the expression of StZIP12 gene induced by R. solanacearum was up-regulated when plants were stressed by R. solanacearum (Fig. 8).

Fig. 8: The relative expression of StZIP12 gene in potato seedlings inoculated with R. solanacearum species complex was analyzed by real-time quantitative PCR. Water was used as control. Normalization is carried out at each point in time based on the value of actin. The value is the average ± standard deviation (SD) (n=3 independent experiments, t-test)

Fig. 9: StZIP12 was located in the phloem and leaf vascular bundles of the stem vascular system. The stem and leaf tissues of potato seedlings were taken 48 h after inoculation with R. solanacearum species complex, and the localization of StZIP12 in cells was observed by laser scanning imaging system. The first column and the second column are blue natural fluorescence, giving priority to the xylem, and the third column is green fluorescence, corresponding to the location of StZIP12. The fourth column is the combined image of the second column of blue

fluorescence and the third column of green fluorescence. (a-a3) Stems of potato seedlings inoculated with R. solanacearum species complex were crosscutting. (b-b3) Stems of potato seedling after water treatment were crosscutting. (c-c3) Leaves of otato seedlings inoculated with R. solanacearum species complex were crosscutting. (d-d3) Leaves of potato seedling after water treatment were crosscutting. The ruler is 20 µm

Conclusion

In conclusion, through bioinformatics analysis of potato ZIP gene family, this study preliminarily explored the role of potato ZIP gene family in plant growth and development. In addition, the expression of StZIP12 was altered by ABA and R. solanacearum treatments, indicating the transcription of StZIP12 is controlled by a complex regulation network during interactions with pathogenic bacteria. In the future, the specific functions need to be further analyzed and verified by means of molecular biology.

Acknowledgements

This study is supported by the National Natural Science Foundation of China (31771858) and the 2020 Shanxi Excellent Graduate Innovation Project of China (2020SY321). Scientific and technological Innovation Project of School-level postgraduates of Shanxi normal University in 2019.

Author Contributions

Ruimin Yu performed primary experiments and and wrote the paper; Ruimin Yu and Yannan Chang analyzed the data; Tian Tian, Yanjie Song and Huanjun Wang was involved in the real-time PCR analysis; Gang Gao initiated and supervised the study and designed the experiments. All authors read and approved the final version of the manuscript

References

Assunção AG, H Schat, MG Aarts (2010). Regulation of the adaptation to zinc deficiency in plants. Plant Signal Behav 5:1553–1555

Bali S, BR Robinson, V Sathuvalli, J Bamberg, A Goyer (2018). Single Nucleotide Polymorphism (SNP) markers associated with high folate content in wild potato species. PLoS One 13; Article e0193415

Blaudez D, A Kohler, F Martin, D Sanders, M Chalot (2003). Poplar metal tolerance protein 1 confers Zinc tolerance and is an oligomeric vacuolar Zinc transporter with an essential leucine zipper motif. Plant Cell 15:2911–2928

Denancé N, P Ranocha, N Oria, X Barlet, MP Rivière, KA Yadeta, L Hoffmann, F Perreau, G Clément, A Maia-Grondard, GCV den Berg, B Savelli, S Fournier, Y Aubert, S Pelletier, BP Thomma, A Molina, L Jouanin, Y Marco, D Goffner (2013). Arabidopsis wat1 (walls are thin1)-mediated resistance to the bacterial vascular pathogen, Ralstonia solanacearum, is accompanied by cross-regulation of salicylic acid and tryptophan metabolism. Plant J 73: 225–239

Dereeper A, S Audic, JM Claverie, G Blanc (2010). BLAST-EXPLORER helps you building datasets for phylogenetic analysis. BMC Evol Biol 10; Article 8

Doxey AC, MWF Yaish, BA Moffatt, M Griffith, BJ McConkey (2007). Functional divergence in the Arabidopsis β-1,3-Glucanase gene family inferred by phylogenetic reconstruction of expression states. Mol Biol Evol 24:1045–1055

Gao S, Y Xiao, F Xu, X Gao, S Cao, F Zhang, G Wang, D Sanders, C Chu (2019). Cytokinin-dependent regulatory module underlies the maintenance of zinc nutrition in rice. New Phytol 224:202–215

Grant MR, JDG Jones (2009). Hormone (Dis) harmony moulds plant health and disease. Science 324:750–752

Grotz N, T Fox, E Connolly, W Park, ML Guerinot, D Eide (1998). Identification of a family of zinc transporter genes from Arabidopsis that respond to zinc defificiency. Proc Natl Acad Sci USA 95:7220–7224

Guerinot ML (2000). The ZIP family of metal transporters. BBA-Biomembr 1465:190–198

He LY, L Sequeira, A Kelman (1983). Characteristics of strains of Pseudomonas solanacearum from China. Plant Dis 67:1357–1361

Kavas M, AK Kızıldoğan, B Abanoz (2017). Comparative genome-wide phylogenetic and expression analysis of SBP genes from potato (Solanum tuberosum). Comput Biol Chem 67:131–140

Kong CY, YP Luo, TT Duan, Z Xue, XD Gao, X Zhao, G Gao (2016). Potato remorin gene strema4 cloning and its spatiotemporal expression pattern under Ralstonia solanacearum and plant hormones treatment. Phytoparasitica 44:575–584

Kozak K, A Papierniak, A Barabasz, M Kendziorek, M Palusińska, LE Williams, DM Antosiewicz (2019). NtZIP11, a new Zn transporter specifically upregulated in tobacco leaves by toxic Zn level. Environ Exp Bot 157:69–78

Lescot M, P Déhais, G Thijs, K Marchal, Y Moreau, DPY Van, P Rouzé, S Rombauts (2002). PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucl Acids Res 30:325–327

Liang Y, N Wan, Z Cheng, Y Mo, B Liu, H Liu, N Raboanatahiry, Y Yin, M Li (2017). Whole-genome identification and expression pattern of the vicinal oxygen chelate family in rapeseed (Brassica napus L.). Front Plant Sci 8; Article 745

Milner MJ, J Seamon, E Craft, LV Kochian (2013). Transport properties of members of the ZIP family in plants and their role in Zn and Mn homeostasis. J Exp Bot 64:369–381

Nussbaumer T, KG Kugler, KC Bader, S Sharma, M Seidel, KF Mayer (2014). RNA Seq Expression Browser-a web interface to browse and visualize high throughput expression data. Bioinformatics 17:2519–2520

Palmer C, M Guerinot (2009). Facing the challenges of Cu, Fe and Zn homeostasis in plants. Nat Chem Biol 5:333–340

Pang PX, L Shi, XJ Wang, YN Chang, YP Luo, JL Feng, H Eri, G Gao (2019). Cloning and expression analysis of the StCUL1 gene in potato. J Plant Biochem Biotechnol 28:460–469

Pedas P, JK Schjoerring, S Husted (2009). Identification and characterization of zinc-starvation-induced zip transporters from barley roots. Plant Physiol Biochem 47:377–383

Pedas P, CK Ytting, AT Fuglsang, TP Jahn, JK Schjoerring, S Husted (2008). Manganese efficiency in barley: Identification and characterization of the metal transporter HvIRT1. Plant Physiol 148:455–466

Peeters N, A Guidot, F Vailleau, M Valls (2013). Ralstonia solanacearum, a widespread bacterial plant pathogen in the post genomic era. Mol Plant Pathol 14: 651–662

Peng WY, Z Ning, L Ting, YJ Wei, Z Xi, FC Xi, LS Gui, SH Jun (2019). Genome-wide identification and expression analysis of StTCP transcription factors of potato (Solanum tuberosum L.). Comput Biol Chem 78:53–63

Plaza S, KL Tearall, FJ Zhao, P Buchner, SP McGrathMcGrath, MJ Hawkesford (2007). Expression and functional analysis of metal transporter genes in two contrasting ecotypes of the hyperaccumulator Thlaspi caerulescens. J Exp Bot 58:1717–1728

Ramesh SA, S Choimes, DP Schachtman (2004). Over-expression of an Arabidopsis zinc transporter in Hordeum vulgare increases short-term zinc uptake after zinc deprivation and seed zinc content. Plant Mol Biol 54:373–385

Scheepers M, J Spielmann, M Boulanger, M Carnol, B Bosman, ED Pauw, E Goormaghtigh, P Motte, M Hanikenne (2020). Intertwined metal homeostasis, oxidative and biotic stress responses in the Arabidopsis frd3 mutant. Plant J 102:34–52

Schmittgen TD, KJ Livak (2008). Analyzing real-time PCR data by the comparative CT method. Nat Protoc 3:1101–1108

Song SW, LY Hao, P Zhao, Y Xu, NQ Zhong, HG Zhang, N Liu (2019). Genome-wide identification, expression profiling and evolutionary analysis of auxin response factor gene family in potato (Solanum tuberosum Group Phureja). Sci Rep 9; Article 1755

Thingholm, TE, L Rönnstrand, PA Rosenberg (2020). Why and how to investigate the role of protein phosphorylation in ZIP and ZnT zinc transporter activity and regulation. Cell Mol Life Sci 77:3085–3102

Thomas P, A Converse, HA Berg (2018). ZIP9, a novel membrane androgen receptor and zinc transporter protein. Gen Compar Endocrinol 257:130–136

Tuteja N (2007). Abscisic acid and abiotic stress signaling. Plant Signal Behav 2:135–138

Wang P, N Yamaji, K Inoue, K Mochida, JF Ma (2020). Plastic transport systems of rice for mineral elements in response to diverse soil environmental changes. New Phytol 226:156–169

Wang XJ, YP Luo, L Shi, PX Pang, G Gao (2019). Analysis of expression characteristics of Scarecrow-Like gene Stsl-1 elicited by exogenous hormone and Ralstonia solanacearum infection in potato. Intl J Agric Biol 22:201–208

Xu YG, BS Wang, JJ Yu, GM Ao, Q Zhao (2010). Cloning and characterisation of ZmZLP1, a gene encoding an endoplasmic reticulum-localised zinc transporter in Zea mays. Funct Plant Biol 37:194–205

Xu Z, XZ Xuan, CL Chen, RZ Hai (2019). Comprehensive analysis of multiprotein bridging factor 1 family genes and SlMBF1c negatively regulate the resistance to Botrytis cinerea in tomato. BMC Plant Biol 19; Article 437

Yang X, J Huang, Y Jiang, HS Zhang (2009). Cloning and functional identification of two members of the ZIP (Zrt, Irt-like protein) gene family in rice (Oryza sativa L.). Mol Biol Rep 36:281–287

Zou Z, J Zhu, X Zhang (2019). Genome-wide identification and characterization of the Dof gene family in cassava (Manihot esculenta). Gene 687:298–307